 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | ND |
|---|---|
| SWISS-PROT | P37478 |
| SubtiList | BG10001 |
| Consensus seq. | TGTWAH-NNNNN-TGTWAH where W = A|T; H=A|C|T |
| Comment | essential gene; transcribed during exponential growth and shut down at the entry into stationary phase (Spo0A-independent); modulates expression of ftsAZ; similar to two-component response regulator [YycG] |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| ftsAZ | ftsA | SigA | Positive | 1595675..1595707 | -70:-38 | TTATTTTTTGTTACACACTTGTAAAGCCACATT |
Howell A, et al. (2003): GS FT Fukuchi K, et al. (2000): RG DP GS SDS-PAGE |
| yocH | yocH | SigA | Positive | 2093064..2093093 | -80:-51 | TCCTTCATGTAAAGGAACTGTAATCTAAAT |
Howell A, et al. (2003): GS FT |
| ykvT | ykvT | None | Positive | 1447586..1447617 | None | TAACAGGTGTAAATAAAATGTAAAGTACCAAA |
Howell A, et al. (2003): HM FT |
| tagDEF | tagD | SigA | Positive | 3680268..3680298 | -177:-147 | CAAAGGATTAACATTATCTTTACATTAAATT |
Howell A, et al. (2003): HM FT |
|