| Factor type | ND |
|---|---|
| SWISS-PROT | P54479 |
| SubtiList | BG11668 |
| Consensus seq. | GATAATGATAATCATTATC |
| Comment | zinc-specific repression of operons implicated in zinc uptake (yciC, ycdHI-yceA) |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| ycdHI-yceA | ycdH | SigA | Negative | 307830..307849 | +7:+26 | ACAAAATCGTTATCATTTTG |
Gaballa A & Helmann JD (1998): DB GS HM RG Gaballa A, et al. (2002): PE |
| yciABC | yciA | SigA | Negative | 363767..363794 | -10:+17 | AAAATAAATAGTAATTATTACGATTTGT |
Gaballa A, et al. (2002): GS FT |
| yciABC | yciC | SigA | Negative | 365583..365602 | +23:+42 | TTTAAATCGTAATCATTCTA |
Gaballa A & Helmann JD (1998): DB RG GS HM FT Gaballa A, et al. (2002): PE |
|