Regulated Operon: abh

Genes
Genes Synonyms Direction Genome position Function COG ID Conserved groups
abh yzaA + 1517865..1518143
COG2002K abrB-BAC-2  

Operon evidence: Genome analysis
Reference: LeDeaux JR & Grossman AD (1995)
Comments:


Promoters

Binding
factor
Regulation Location Absolute position Binding seq.(cis-element) Experimental evidence
SigW Promoter -36:+6 1517766..1517807 CGGGAAACTTTTTCAAAGTTTCATTCGTCTACGATATATTGA Huang X & Helmann JD (1998): PE
Huang X, et al. (1998): RO
SigX Promoter -40:+2 1517766..1517807 CGGGAAACTTTTTCAAAGTTTCATTCGTCTACGATATATTGA Huang X & Helmann JD (1998): PE RG
Huang X, et al. (1998): RO

Terminator

Terminator sequence Absolute position Position from stop codon Free energy
[kcal/mol]
Downstream of
AAAAAGGCGGAGTGATATCATCTCCGCCTTTTTTGCGTGCCAA
     >>>>>>>>>    <<<<<<<<<<
1518159..1518181
16..38
-15.2
abh

Overview



Upper Region






Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai