Transcription factor: SigW

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TGAAACN(16)CGTA
Comment ECF-type sigma factor
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
abh abh 1517766..1517807 -36:+6 CGGGAAACTTTTTCAAAGTTTCATTCGTCTACGATATATTGA Huang X & Helmann JD (1998): PE
Huang X, et al. (1998): RO
yabMNOPQ-divIC-yabR divIC 69018..69059 -36:+6 TTTGAAACTTCTTCCTGTGAAAATGCGTCTAACTTTTAGACG Huang X, et al. (1998): RO
Cao M, et al. (2002): AR
pbpE-racX pbpE 3535484..3535526 -40:+3 ATATTTGAAACGTTAGTAGGTTAGTAACGTACAGAGATATGGG Huang X, et al. (1999): S1 DB RG
Popham DL, et al. (1993): PE
Cao M, et al. (2002): AR
pbpX pbpX 1765780..1765818 None TTTTTGACAACTTTTTTAGGGCTTTATTCGTCTAACAAA Cao M & Helmann JD (2004): RG
pspA-ydjGHI pspA 671169..671213 -40:+5 AAAAGTGAAACTTTTAACGATAATAAATAGTATATGTAACAAGGG Wiegert T, et al. (2001): AR PE DB RG
Cao M, et al. (2002): ROMA AR RG PE RO
Cao M, et al. (2002): AR
sigW-ybbM sigW 194782..194824 -39:+4 AAAATTGAAACCTTTTGAAACGAAGCTCGTATACATACAGACC Huang X, et al. (1999): DB RG PE, in vitro transcription, RO
Cao M, et al. (2002): AR
sppA-yteJ sppA 3021072..3021112 -38:+3 TGAAGTGAAACATTTTTCATATTGAATCGTATAATGAGAGA Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
xpaC-yaaN xpaC 35765..35807 None GAAGATGAAACTTGTTTAAGGATTGAACGTAGTAGATAATAAT Huang X, et al. (1999): RO
Cao M, et al. (2002): AR
ybfO ybfO 249911..249949 None GAAAAGGAAACTTTTTCTATATCTATCTCGTAATGACTA Cao M, et al. (2002): ROMA AR RG
Cao M, et al. (2002): AR
yceCDEFGH yceC 312040..312082 -40:+3 TTTTACGAAACTTTGATATAATAACAAACGTATATATTAGTAA Cao M, et al. (2002): ROMA AR RG RO PE
Cao M, et al. (2002): AR
ydbST ydbS 512749..512791 -38:+5 AAGAATGAAACCTTTCTGTAAAAGAGACGTATAAATAACGACG Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yeaA-ydjP-ydjO yeaA 683385..683427 -37:+6 CTTTATGAAACCTTTGGCCCTATTTATCGTATTACGTAAAAAC Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yfhKLM yfhL 929352..929395 -38:+6 ATGCATGAAACATTTCTTCTTTCTGCACGTAACAATGAGAAAGG Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yjbCD yjbC 1226822..1226865 -40:+4 AAAAATGAAACCATGGCGGAAGTTCGCACGTCTTTATAGATGTA Antelmann H, et al. (2000): PE NB
Cao M, et al. (2002): HM RO RG DB
Cao M, et al. (2002): AR
yjoB yjoB 1314385..1314427 -39:+4 TGGGATGAAACAAAATGCTATGTCAATCGTATATATAACGTTC Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yknWXYZ yknW 1503518..1503560 -39:+4 AAACATGAAACTTTTTGATATCCTTCCCGTACTATTTGTTAGA Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yndN yndN 1916595..1916639 -41:+4 CTGTATGAAACTTTCTTATGAAAAAAGTCGTATATGTGGATGATC Cao M, et al. (2001): PE RG DB OV
Cao M, et al. (2002): AR
yoaF yoaF 2027445..2027483 None AATAATGAAACCCGGAGTATGCCAAGCCCGTATAACATA Cao M, et al. (2002): ROMA AR RG
Cao M, et al. (2002): AR
yoaG yoaG 2028669..2028707 None ATTTTTGAAACCTTTTATTAGCGCATTGCGTATAGCACG Cao M, et al. (2002): ROMA AR RG
Cao M, et al. (2002): AR
yobJ yobJ 2071111..2071153 -39:+4 TTATATGAAACCTTTTTTATTTTAGCCCGTATTAAAAGTAAAT Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yozO yozO 2099959..2099997 None AATATTGAAACTTTTTTCTCTATATGTGCGTATTACTTG Cao M, et al. (2002): HM AR DB
Cao M, et al. (2002): AR
yqeZ-yqfA-yqfB yqeZ 2619819..2619857 None AAAAATGAAACCTTTGATACATTTGTTACGTATGAAGAG Cao M, et al. (2002): ROMA AR RG
Cao M, et al. (2002): AR
yqjL yqjL 2476904..2476941 None TTAGAGAAACGATCGGCTAAGGTTCTCCGTCTCCCTAG Cao M, et al. (2002): RO
Cao M, et al. (2002): AR
yrhH yrhH 2778501..2778545 -39:+6 TCTATTGAAACATTTTTCAATACATTGCCGTCTAGTTGGTACCTT Huang X & Helmann JD (1998): DB RG
Huang X, et al. (1998): RO
Cao M, et al. (2002): AR
ysdB ysdB 2951419..2951461 -39:+4 AAAAGTGAAACCTTTTTCTATGCTTTTCGTATTACATCAGATC Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
ythPQ ythP 3072128..3072165 None GTTAAAGAAACTTTTTTTATTCTATTTCGTAGTAAATT Cao M, et al. (2002): ROMA AR RG
Cao M, et al. (2002): AR
yuaFGI yuaF 3182582..3182624 -39:+4 AATTTTGAAACTTTTCCCGAGGTGTCTCGTATAAATGGTAACG Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yvlABCD yvlA 3608825..3608867 -38:+5 GAATTTGAAACCTGAAGAGATTTTAAACGTATAAATAAGTAAA Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
ywaC ywaC 3950621..3950662 -39:+3 ATTCATAGAACCTTGCAGCAGACAGGGACGTCTAGTACATGG Cao M, et al. (2002): ROMA AR RG PE RO
ywbLMN ywbN 3928032..3928076 -39:+6 AAATACAAAACAAATGATCAGTCCTATACGTCTTATGATAAATTA Huang X, et al. (1998): RO
Cao M, et al. (2002): ROMA AR RG PE
ywnJ ywnJ 3759619..3759671 -44:+9 TTTTTTTCTGTTACTTTTTGCTTTGTTTTACCGTCTATGTAGTTACATGTAGG Cao M, et al. (2002): AR
Cao M & Helmann JD (2004): RO PE
ywrE ywrE 3718738..3718780 -39:+4 TTTTATGAAACGTTTTTCCTTTTTCTTCGTATAAAGGTAGATT Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yxjJI yxjI 3997154..3997196 -40:+3 GAGCCTGAAACCTTTTCGCCACCTATCCGTAATTTCATACAAG Huang X, et al. (1999): S1
Cao M, et al. (2002): AR
yxzE yxzE 3982908..3982950 -39:+4 TGAAATGAAACCGGTCAGCGTTTCATCCGTATAACAGATATGG Huang X, et al. (1999): S1




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai