Transcription factor: SigX

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TGTAACN(17)CGAC
Comment ECF-type sigma factor
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
abh abh 1517766..1517807 -40:+2 CGGGAAACTTTTTCAAAGTTTCATTCGTCTACGATATATTGA Huang X & Helmann JD (1998): PE RG
Huang X, et al. (1998): RO
csbB csbB 930702..930743 -36:+6 ATTGTAACAAAAAACAGGTTTAAACGACTTTAAAAAAAGGAA Huang X & Helmann JD (1998): PE RG DB
yabMNOPQ-divIC-yabR divIC 69018..69059 -36:+6 TTTGAAACTTCTTCCTGTGAAAATGCGTCTAACTTTTAGACG Huang X & Helmann JD (1998): PE RG DB
Huang X, et al. (1998): RO
Cao M, et al. (2002): AR
dltABCDE dltA 3952033..3952082 -38:+12 AAAATGAAACTTTTTGAGCATCTGATCGTCAAATAATCATGTGATTGTCG Cao M & Helmann JD (2004): ROMA RG PE
lytR lytR 3663161..3663202 -36:+6 AATGAAACTTTTTTTTATAAAAAACGACTATTTTAGGATTTC Huang X & Helmann JD (1998): DB RG PE
Lazarevic V, et al. (1992): PE
pbpX pbpX 1765780..1765818 None TTTTTGACAACTTTTTTAGGGCTTTATTCGTCTAACAAA Cao M & Helmann JD (2004): ROMA RG
pssA-ybfM-psd pssA 247672..247718 -39:+8 TTCCTGTAACGCTATTCGATCACTATCGTCAAATAATATAGATGGTT Cao M & Helmann JD (2004): ROMA RG
rapD rapD 3744267..3744308 -37:+5 AATGTAACCAACTGTCAATGAGAGCCGTCAAAAGTTATGATA Huang X & Helmann JD (1998): RG DB PE RO
sigX-rsiX sigX 2415224..2415265 -37:+5 AATGTAACTTTTCAAGCTATTCATACGACAAAAAAGTGAACG Huang X, et al. (1997): RO, in-vitro transcription, PE DB RG
Huang X & Helmann JD (1998): SDM RG DB PE
yjbCD yjbC 1226822..1226865 -40:+4 AAAAATGAAACCATGGCGGAAGTTCGCACGTCTTTATAGATGTA Antelmann H, et al. (2000): PE NB
Cao M, et al. (2002): HM RO RG DB
Cao M, et al. (2002): AR
yqjL yqjL 2476904..2476941 None TTAGAGAAACGATCGGCTAAGGTTCTCCGTCTCCCTAG Cao M, et al. (2002): ROMA
Cao M, et al. (2002): AR
yrhH yrhH 2778501..2778545 -39:+6 TCTATTGAAACATTTTTCAATACATTGCCGTCTAGTTGGTACCTT Huang X & Helmann JD (1998): RO
Huang X, et al. (1998): RO
Cao M, et al. (2002): AR
ywbLMN ywbN 3928032..3928076 -39:+6 AAATACAAAACAAATGATCAGTCCTATACGTCTTATGATAAATTA Huang X & Helmann JD (1998): RO PE
Huang X, et al. (1998): RO
ywnJ ywnJ 3759619..3759671 -44:+9 TTTTTTTCTGTTACTTTTTGCTTTGTTTTACCGTCTATGTAGTTACATGTAGG Cao M & Helmann JD (2004): ROMA RG PE
Cao M, et al. (2002): AR
ywoA ywoA 3758484..3758527 -38:+6 TTATTTGAAACTTTTCATGAGTAAGATTAGTCTACTAAATATAA Cao M & Helmann JD (2002): ROMA AR DB RG PE HB
Cao M, et al. (2002): AR
Ohki R, et al. (2003): NB RG DB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai