 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | cgeCDE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| cgeC | cgeBA | - | 2148166..2148471 | |||
| cgeD | cgeBB | - | 2146821..2148101 | COG0463M | ||
| cgeE | cgeBC | - | 2146013..2146792 | COG1246E |
| Operon evidence: | Northern blotting (2.7 kb transcript) |
|---|---|
| Reference: | Roels S & Losick R (1995) |
| Comments: | potential readthrough terminator is located downstream of cgeC, leading to a 0.4 kb monocistronic cgeC transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GerE | Positive | -126:-95 | 2148593..2148624 | CTGTTATTTGGTATGAGTCGAACGCCGTACCT |
Roels S, et al. (1995): HB |
| SigK | Promoter | -43:+5 | 2148494..2148541 | CATAGCCTATACCATAAATCGAAGTCGCACATATTGTGAAACAGAGAT |
Roels S, et al. (1995): PE NB DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAATTTCAAAAGAGCCTTCCTTATTAGGAAGGCTCTTTTTATGTGAAAAA >>>>>>>>>> <<<<<<<<<< |
cgeE |
|