Transcription factor: SigK

Factor type ND
SWISS-PROT P12254
SubtiList BG10459
Consensus seq. (c/a)AC(c/a)(-35) - 16bp - CATA---TA(-10)
Comment sigK is formed by a site-specific recombination event which joins the previously separated spoIVCB and spoIIIC genes into a single cistron.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
cgeAB cgeA 2148603..2148650 -43:+5 TTCGACTCATACCAAATAACAGCCGGAAGAATATGAATAACGTGAGTT Roels S, et al. (1995): PE NB DB
cgeCDE cgeC 2148494..2148541 -43:+5 CATAGCCTATACCATAAATCGAAGTCGCACATATTGTGAAACAGAGAT Roels S, et al. (1995): PE NB DB
cotA cotA 685033..685080 -42:+6 ATTTTTTGTAACCATCACGTCCTTATTGTCATTAACTATAGTACCAAT Sandman K, et al. (1988): RG DP S1
cotB cotB 3715918..3715964 -43:+4 TTGAATTAGTTCAACAAATAAATGTGACACGTATATATGCAGTATGT Zheng LB & Losick R (1990): PE
cotC cotC 1905216..1905262 -41:+6 AACTGTCCAAGCCGCAAAATCTACTCGCCGTATAATAAAGCGTAGTA Zheng L, et al. (1992): PE
Zheng LB & Losick R (1990): PE RG DP
cotD cotD 2333038..2333085 -43:+5 TTGCATCAGAACATGTACCCCTTATTTTTCATAACTTAGTATTGTAAT Zheng LB & Losick R (1990): S1 RG
cotE cotE 1774999..1775046 -43:+5 ATAAAAATGCACACTAGACAAATGCCCAGCATAAGATAACACGAAGAA Zheng LB & Losick R (1990): PE S1 RG DP
Eichenberger P, et al. (2004): GS
cotF cotF 4167039..4167083 -43:+2 AACATCATGAACAACATTGAGCGTTGGGCATATGCTGATATGGAA Cutting S, et al. (1991): PE
cotG cotG 3717149..3717193 -42:+3 GAACACTTATACACTTTTTAAAACCGCGCGTACTATGAGGGTAGT Sacco M, et al. (1995): PE RG
cotH cotH 3717181..3717240 -44:+16 CAATTTGAAATCCTCCTTTTAAAAATATGTTAAGGATGAAGATCCTTACTACCCTCATAG Naclerio G, et al. (1996): PE DB
cotM cotM 1926049..1926108 -50:+10 CTGTTTTTTTATGCGTTCACCCATTTATAATCCACCGCATATGATGTAAAGCAAGGTTGA Henriques AO, et al. (1997): PE DB RG
Reischl S, et al. (2001): RG HB DB
yozR yozR 2123939..2124023 None CTTTAGAGCATCTTATATTATATCACGTGAAAGATCTGGTGGGCATATACTATTTTGTCCGTGAAGAAAGGATGTGAAGACAATG Ferguson CC, et al. (2007): DB RG HM
ydgBA-cotP ydgB 602726..602777 None CAAGGAACAATTGGGTGCAGCGGCGCATAATGTACTGTACAGAAAGATGGAA Reischl S, et al. (2001): RG HB DB
cotSA-cotS-ytxO cotSA 3161928..3161972 -42:+3 CCCATTCCGCACAAGTTGGTTGTTCAGCCGTATCATGATTCTAAC Abe A, et al. (1995): NB PE
Takamatsu H, et al. (1998): DB NB RG
Kuwana R, et al. (2002): SDS-PAGE, RG
cotT cotT 1280894..1280949 -46:+10 ATGAATGTACATACACCCAACTTAAGCATCAGGAATATGGTAAAAGGAATAAAAAA Bourne N, et al. (1991): PE
Aronson AI, et al. (1989): S1 NB
Eichenberger P, et al. (2004): HM AR
cotVWX cotV 1252036..1252083 -42:+6 TTTTATTATTCCGCTCTGCACCCCATTTGCATTATATAGAGTATGGAT Zhang J, et al. (1994): NB PE DB RO
cotVWX cotX 1251191..1251238 -43:+5 TATGACTCAGTCAAAATAAGAGGCTCGCTCATTTAATAACAGTAAAAG Zhang J, et al. (1994): NB PE DB RO
cotYZ cotY 1250540..1250587 -44:+4 GTTCACCCACACCAAGTGGGGCACGGGTACATATGTTGTTAAGGACTA Zhang J, et al. (1994): NB PE DB RO
cwlC cwlC 1873587..1873633 -41:+6 AATCGTACAAGCAGAAGCCGTGTTTTTTCATATCCTGTAATGAGGTG Kuroda A, et al. (1993): RG DB NB PE
cwlH cwlH 2649656..2649709 -40:+14 AAAGGCTGTCCATCTCTCTGTTTTCTGCATTCTTATTAATAGGGAGGGATAGAA Nugroho FA, et al. (1999): RG PE HM
rnc-smc-ftsY ftsY 1669382..1669436 -50:+5 ACTCCAATACTTACGGGAGGAATACAGCTTGTCCTTTGAGGGGGCAAAAGAGAAA Kakeshita H, et al. (2000): PE
gerE gerE 2905008..2905055 -42:+6 TGTAAACGTCACCTCCTGCGCCCTTCTTACATATGATATCTCGACTAT Cutting S, et al. (1989): PE RG
gerPABCDEF gerPA 1150506..1150544 None TTTCTCTCACACATATGTGCGTTTGTCATAAGCTATCGT Behravan J, et al. (2000): OV RG
Eichenberger P, et al. (2004): HM
spoIVCB-spoIIIC spoIVCB 2652915..2652962 -39:+9 CGGTACAGACACAGACAGCCTCCCGGTCACATACATTTACATATAGGC Kunkel B, et al. (1988): PE RG
Kroos L, et al. (1989): RO, SDS-PAGE
spoVFAB-asd-dapG-dapA spoVFA 1744274..1744324 -40:+11 TTTTATATTCACCGGTATTTCCTTTTGATCATAAGATGAAGGGGAGCTTAA Chen NY, et al. (1993): PE
Daniel RA & Errington J (1993): RG PE DB
spoVK spoVK 1874144..1874190 -42:+5 GGCGTTTGTCACAATCGGCATCCGCTTGAATATCATATAGAGAGAAC Foulger D & Errington J (1991): PE RG DP DB
sps spsA 3893155..3893198 -39:+5 CCTAGCGCAACTTGAGCATAAGCAACATAAGATAACGATAGTTT Eichenberger P, et al. (2004): Race-PCR
sspG-yurS sspG 3354003..3354045 -40:+3 CGTCCAATCTCTTTACTCTCCTATCGAATATCCTGTCACTATC Bagyan I, et al. (1998): PE RG DB
tgl tgl 3212535..3212593 -35:+24 TAACTTTCATTGCCCAAGCTCTTTGCATATCTTATAAAAAACAAGGGGGGCTAAACATG Kobayashi K, et al. (1998): HM
Eichenberger P, et al. (2004): Race-PCR
yabG yabG 51529..51574 -42:+4 TGTTTTGCGCACCACATGGACTGCCGCTACATAGGCTAGAGAAGGA Takamatsu H, et al. (2000): PE
ycsFGI-kipIAR-ycsK ycsK ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yfhP yfhP 935567..935604 None GTTGTACACTAAGGGCACAGTACGATAATATGTTACAT Fujita M (1999): in-vitro transcription
Yamamoto H, et al. (1999): NB RG
yfhP yfhP 935555..935593 None AGGGCACAGTACGATAATATGTTACATTAAATAGTAATA Fujita M (1999): in-vitro transcription
Yamamoto H, et al. (1999): NB RG
yfnHGFED yfnE 801172..801214 -37:+6 GTGAAAGCAAGCGTTATTATTCCTGCATATAATTCGAAGGAGC Eichenberger P, et al. (2004): Race-PCR
yfnHGFED yfnH 798321..798365 -39:+6 TTGGTCACCAAGGCTGGCTTTCTCTCATATCATTACAGTAGATTT Eichenberger P, et al. (2004): Race-PCR
yhcOP yhcO 989634..989683 -39:+11 AATGACACACTGCGAACTCAGGCTGCATAGAGTAAAAATAAAAAGGTACA Eichenberger P, et al. (2004): Race-PCR
yhjR yhjR 1136154..1136208 -37:+18 CTCCGCACATCTCTCCCTGCCCAACATATACTTTTACAGAAGCCCAATTCCTAAG Eichenberger P, et al. (2004): Race-PCR
yitBA-yisZ yitB 1172506..1172550 -38:+7 ACCTGAACCTTTATGCAAAAAATGAATAGTCTGCCTATAACTCGA Eichenberger P, et al. (2004): Race-PCR
yitCD yitC 1172580..1172632 -40:+13 TGCGGAACCATTAAGAGCCCGGCTGAATATGCTTTTTAGCAAAATGGTTTTAT Eichenberger P, et al. (2004): Race-PCR
yjcB-yjcZ-spoVIF yjcB 1252756..1252812 -45:+12 TTTTTGTTTTTTTAACGAGGCGGTCTCGCTCAGCATATATCATAAGCGGGGGGATAA Kuwana R, et al. (2003): NB DB PE
yjcB-yjcZ-spoVIF yjcZ 1253038..1253091 -43:+11 TGCGAATATCCAAGCCGATCCCAGCAGCTCACATAGTGTATAGAGAGTAAAGGA Kuwana R, et al. (2003): NB DB PE
yjcB-yjcZ-spoVIF yjcC 1253314..1253369 -45:+11 ATGTTGGAAAAGCACATTGTATTATGTGCATTCATACAATACCGTATTACTCCGCC Kuwana R, et al. (2003): NB DB PE
ykuD ykuD 1477010..1477070 -38:+23 AATGTAGCAGGATGGGCTCCTCATCAATACTTATAAGTAAAAAAGGAGGATGAGGAAACTG Eichenberger P, et al. (2004): Race-PCR
Kodama T, et al. (2000): NB DB
ykvPQ ykvP ND ND ND Kodama T, et al. (2000): NB DB
ylbDE ylbD 1567583..1567633 -38:+13 AGGCGAACACAATGCCCGACAAAACGATACATTGTAGTAGGTAACGATTTT Eichenberger P, et al. (2004): Race-PCR
ymaG ymaG ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yndL yndL 1915081..1915132 -43:+9 AAAATGAGAAGAACAGCGCCCGGGCTAATGGTATATAATATTGTGAATTTAA Silvaggi JM, et al. (2006): PE NB DB
Eichenberger P, et al. (2004): AR
yngK yngK 1959593..1959635 -38:+5 TTAATCACCCTTTTATAGCCCGGGAATACCGTAATAGCGAATA Eichenberger P, et al. (2004): Race-PCR
yoaN yoaN 2038795..2038846 -37:+15 TAGGCACAGCAATCTAAGATTCTGCATAGGCTGAAATAAAATCTTGTTCATT Costa T, et al. (2004): NB RG HM
Eichenberger P, et al. (2004): Race-PCR
yobW yobW 2084153..2084204 -43:+9 ATTTCAGCTACTATTTCCGACCGGATAAGCATACACTTCTCAACGGAGGGGA Henriques AO, et al. (1997): PE HM DB RG
yodHI yodH 2133401..2133457 -36:+21 TCATAAACCTATGTCTTTATACGACATATGATAAGGAAAAAGGAGGATTCGATATTG Eichenberger P, et al. (2004): Race-PCR
ypqA ypqA 2337521..2337569 -37:+12 TTTATAACAACATCTGGCATAGACGCATAATCTGGTTAAAAAAGGCGGT Eichenberger P, et al. (2004): Race-PCR
yqfQ yqfQ ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yrkC yrkC 2715511..2715561 -38:+13 TTTAGCACACTCCCTTAATAAATGCATAGGATACTATCACAAAAATTTATA Kuwana R, et al. (2002): SDS-PAGE, RG
Eichenberger P, et al. (2004): Race-PCR
ysnD ysnD 2897725..2897770 -37:+9 ATAGGCACTTCTCTTGTTCCCTCGGCATACATTAATGATATCTTGC Eichenberger P, et al. (2004): Race-PCR
ytaA ytaA ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
ytcC ytcC ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
ytlABCD ytlA 3132286..3132329 -36:+8 GCATTCACACATTTTTATACCCATCATACGATATGTAAAGCAAA Eichenberger P, et al. (2004): Race-PCR
ywrJ ywrJ ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yxeE yxeE 4065531..4065579 -37:+11 ATGCCGTGCCACTGTGCCAATGACTACATAAGTTATAAGGAATTCACCC Eichenberger P, et al. (2004): Race-PCR
Takamatsu H, et al. (2000): SDS-PAGE
Kuwana R, et al. (2008): DB NB PE




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai