Transcription factor: GerE

Factor type LuxR/UhpA
SWISS-PROT ND
SubtiList ND
Consensus seq. RWWTRGGY--YY
Comment Positive(?) regulator which affects transcription of many genes in the mother cell during the late stages of sporulation
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
cgeAB cgeA SigK Positive 2148574..2148605 -72:-41 AATAGATGAAAAATAGATCAGGTACGGCGTTC Roels S, et al. (1995): HB
cgeAB cgeA SigK Positive 2148563..2148594 -83:-52 CATTTTCCTTAAATAGATGAAAAATAGATCAG Roels S, et al. (1995): HB
cgeAB cgeA SigK Positive 2148546..2148577 -100:-69 CTCCATTAAAAAATCAGCATTTTCCTTAAATA Roels S, et al. (1995): HB
cgeAB cgeA SigK Positive 2148520..2148551 -126:-95 TCGATTTATGGTATAGGCTATGTCCACTCCAT Roels S, et al. (1995): HB
cgeAB cgeA SigK Positive 2148498..2148529 -148:-117 CTGTTTCACAATATGTGCGACTTCGATTTATG Roels S, et al. (1995): HB
cgeCDE cgeC SigK Positive 2148593..2148624 -126:-95 CTGTTATTTGGTATGAGTCGAACGCCGTACCT Roels S, et al. (1995): HB
cotA cotA SigK Negative ND ND ND Zheng L, et al. (1992): DB RO
cotB cotB SigK Positive 3715983..3716002 -81:-62 GAAAATGGGTATTCGCGGAA Zheng L, et al. (1992): GS FT RO
cotB cotB SigK Positive 3715962..3715982 -71:-41 AAAGCGACAATTAGGCTATTG Zheng L, et al. (1992): GS FT RO
cotC cotC SigK Positive 1905347..1905362 -141:-126 CGTTTGGGCCGATGAA Zheng L, et al. (1992): GS FT RO
cotC cotC SigK Positive 1905277..1905298 -77:-56 ATCATTTGGACAGCCCTTTTTT Zheng L, et al. (1992): GS FT RO
cotD cotD SigK Pos/Neg 2333074..2333105 -63:-32 CACACTTTTAAAATAGGTCTTTGCATCAGAAC Ichikawa H, et al. (1999): FT
cotD cotD SigK Pos/Neg 2333052..2333083 -41:-10 GCATCAGAACATGTACCCCTTATTTTTCATAA Ichikawa H, et al. (1999): FT
cotG cotG SigK Positive 3717107..3717138 -85:-54 TCCTTACAAATTTTAGGCTTTTATTTTTATAA Sacco M, et al. (1995): DB
cotH cotH SigK Negative 3717114..3717131 +66:+83 AATAAAAGCCTAAAATTT Baccigalupi L, et al. (2004): RG FT, binding site mutation
cotM cotM SigK Negative 1926077..1926100 -42:-19 TTATGCGTTCACCCATTTATAATC Henriques AO, et al. (1997): DB RG
yozR yozR SigK Negative ND ND ND Ferguson CC, et al. (2007): DB RG FP
ydgBA-cotP ydgB SigK Negative 602754..602777 None CAAGGAACAATTGGGTGCAGCGGC Henriques AO, et al. (1997): DB RG
cotVWX cotV SigK Positive 1252073..1252094 -53:-32 AAATTGGTTATTTTTATTATTC Zhang J, et al. (1994): FT RO
cotVWX cotX SigK Positive 1251245..1251265 -70:-50 TAAAAAATAGGGTTCTTCATC Zhang J, et al. (1994): FT RO
cotVWX cotX SigK Positive 1251227..1251245 -50:-32 CAGGATATATGACTCAGTC Zhang J, et al. (1994): FT RO
cotYZ cotY SigK Positive 1250577..1250600 -57:-34 TGAATATATAGACGTTCACCCACA Zhang J, et al. (1994): FT RO
cotYZ cotY SigK Positive 1250576..1250592 -49:-33 TAGACGTTCACCCACAC Zhang J, et al. (1994): FT RO
cwlH cwlH SigK Positive 2649808..2649828 -160:-140 CCCAACTTAGGTGATGTCAGG Nugroho FA, et al. (1999): RG PE HM
rnc-smc-ftsY ftsY SigK Positive 1669339..1669370 -83:-62 AAGAAGTCAAACTTGGACGAATGGAAGTCGAG Kakeshita H, et al. (2000): PE NB
rnc-smc-ftsY ftsY SigK Positive 1669289..1669320 -143:-111 GAAAGAAATGAAACGCCTGTATAAACAAAAAA Kakeshita H, et al. (2000): PE NB
gerPABCDEF gerPA SigK Negative ND ND ND Behravan J, et al. (2000): DB RG
Eichenberger P, et al. (2004): DB AR
spoIVCB-spoIIIC spoIVCB SigE/SigK Negative 2652945..2652975 -9:+22 ATACATTTACATATAGGCTTTTGCCTACATA Zheng L, et al. (1992): RO
Ichikawa H, et al. (1999): FT RG
spoIVCB-spoIIIC spoIVCB SigE/SigK Negative 2652953..2652984 -1:+31 ACATATAGGCTTTTGCCTACATACTTTTGTGG Zheng L, et al. (1992): RO
Ichikawa H, et al. (1999): FT RG
sspG-yurS sspG SigK Positive 3353944..3353975 -99:-68 TTACCAAATCAAATGCTTTCCTTCGACCTTTT Bagyan I, et al. (1998): DB RG
sspG-yurS sspG SigK Positive 3353980..3354012 -63:-31 TAATGTGGAAAAACCGCGAAGTTCGTCCAATCT Bagyan I, et al. (1998): DB RG
yjcB-yjcZ-spoVIF yjcZ SigK Positive 1253007..1253052 -74:-29 TATGATCAATCGTAAATCCGCAAACGCCCTATGCGAATATCCAAGC Kuwana R, et al. (2003): NB DB HM
yoaN yoaN SigK Negative ND ND ND Costa T, et al. (2004): NB SDS-PAGE RG, GFP localization
yxeE yxeE SigK Positive 4065516..4065589 -53:+21 TCCTTTTTTGGGCGAATGCCGTGCCACTGTGCCAATGACTACATAAGTTATAAGGAATTCACCCACAAGGAGAC Kuwana R, et al. (2008): DB NB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai