 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | comEABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| comEA | comD | - | 2640513..2641130 | COG1555L | ||
| comEB | comD | - | 2639877..2640446 | COG2131F | comEB-BAC comEB-STA | |
| comEC | comD | - | 2637543..2639873 | COG2333R |
| Operon evidence: | S1 nuclease mapping |
|---|---|
| Reference: | Hahn J, et al. (1993) |
| Comments: | A minor promoter exists between comEA and comEB. The terminators proposed in the paper do not agree well with the S1 nuclease mapping result. A second termination site was found experimentally by Hahn et al. about 230 basepairs from the stop codon. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | -82:-58 | 2642093..2642117 | AAACCATCGTTTCCTAAAACGATGG |
Guillen N, et al. (1989): DB RG Van Sinderen D, et al. (1994): DB RG Van Sinderen D, et al. (1995): GS Hamoen LW, et al. (1998): FT |
| ComK | Positive | -58:-32 | 2642065..2642093 | GTTTTTTAAAATGCTTTTTTATGCTTTTG |
Guillen N, et al. (1989): DB RG Van Sinderen D, et al. (1994): DB RG Van Sinderen D, et al. (1995): GS Hamoen LW, et al. (1998): FT |
| SigA | Promoter | -50:+19 | 2642015..2642083 | ATGCTTTTTTATGCTTTTGCAGTACAGACGAACGTATGACATACTCGTCTACACATGAAACTGCTTTTT |
Hahn J, et al. (1993): PE S1 |
|