 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | dhbACEBF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| dhbA | entA | - | 3291511..3292296 | COG1028IQR | ||
| dhbC | - | 3290289..3291485 | COG1169HQ | dhbC-BAC | ||
| dhbE | entE | - | 3288641..3290260 | COG1021Q | dhbE-BAC dhbE-BAC | |
| dhbB | - | 3287675..3288613 | COG1535Q | dhbB-BAC | ||
| dhbF | - | 3280519..3287655 | COG1020Q |
| Operon evidence: | operon disruption |
|---|---|
| Reference: | Rowland BM, et al. (1996) |
| Comments: | operon disruption showed that at least the first four genes belong to the same operon |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Fur | Negative | +7:+22 | 3292363..3292412 | TTATTTTTATAATTGATAATGATAATCATTATCAATAGATTGCGTTTTTC |
Baichoo N, et al. (2002): FT Ollinger J, et al. (2006): DB SDS-PAGE |
| SigA | Promoter | -39:+1 | 3292405..3292444 | ATATTTGACTGTCACATGACATTTGGATATGATTATTTTT |
Rowland BM & Taber HW (1996): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGAGACTGCTTGCCGCAGTCTCTTTTTCTATCTTACG >>>>>>>> <<<<<<<< |
dhbF |
|