 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yccC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yccC | ansZ | + | 290467..291594 |
| Operon evidence: | Genome analysis; upstream gene is on the opposite strand; the downstream lip gene was shown to be monocistronic in a Northern blotting experiment |
|---|---|
| Reference: | Fisher SH & Wray LV Jr (2002) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -40:+6 | 290848..290893 | GATCTTTTGACTGAATAGATAAAATGTACAATGATTAATCATCATA |
Fisher SH & Wray LV Jr (2002): PE |
| TnrA | Positive | -60:-37 | 290828..290851 | TACTGAGAGAAAAGCTGACTGATC |
Fisher SH & Wray LV Jr (2002): FT GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAAGAAGGCGAATAAGCCTTCTTTTTTTTGGCTTTT >>>>>> <<<<<< |
yccC |
|