 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ycsFGI-kipIAR-ycsK |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ycsF | + | 457023..457796 | COG1540R | |||
| ycsG | ycsH | + | 457811..459025 | COG1914P | ||
| ycsI | + | 459049..459822 | COG4336S | |||
| kipI | ycsJ | + | 459867..460589 | COG2049E | ||
| kipA | + | 460592..461599 | COG1984E | |||
| kipR | ycsO | + | 461615..462367 | COG1414K | ||
| ycsK | + | 461988..462629 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Wang L, et al. (1997) |
| Comments: | Northern blotting results in BSORF show a monocistronic ycsF transcript (0.65 kb), a ycsGI-kipIAR transcript (4.5 kb), and a monocistronic ycsK transcript (0.65 kb). |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| KipR | Negative | ND | ND | ND |
Wang L, et al. (1997): DB |
| TnrA | Positive | ND | ND | ND |
Wang L, et al. (1997): DB |
| SigK | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAACGCGCCTCATGACAGGCGCGTTTTTTATGTGTGAT >>>>>>> <<<<<<< |
ycsK |
|