 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxzE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxzE | + | 3982973..3983173 |
| Operon evidence: | downstream genes are on the opposite strand |
|---|---|
| Reference: | Huang X, et al. (1999) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | -17:+25 | 3982930..3982971 | TCATCCGTATAACAGATATGGTGAAAAAAGGGAGTGACGCGA |
Qian Q, et al. (2002): RG FT |
| SigW | Promoter | -39:+4 | 3982908..3982950 | TGAAATGAAACCGGTCAGCGTTTCATCCGTATAACAGATATGG |
Huang X, et al. (1999): S1 |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGAGGGGGCGGCGATTAAACGCCGCCTTTTTTTATTTCATTG >>>>>>>> <<<<<<<< |
yxzE |
|