Transcription factor: ResD

Factor type LuxR/UhpA
SWISS-PROT ND
SubtiList ND
Consensus seq. ANNTNTTTNNNAAGTGTT
Comment resD seems to form a two-component signal transduction system with resE and plays a regulatory role in respiration. Interactions with resABCDE operon and ctaA may be indirect
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ctaA ctaA SigA;SigE(?) Positive 1559036..1559088 -108:-55 TACATTTTCCAGAAGCCGTCATTCTATTATATTTTTGTGAACAAAAGGCTCTG Paul S, et al. (2001): GS PE, in-vitro transcription assay
Zhang X & Hulett FM (2000): GS FT DP RG
Sun G, et al. (1996): DB
ctaA ctaA SigE(?) Positive 1558940..1558984 -2:+43 GCAGCAGTATGTTAAGAAGGTGAATATTGTATGAATAAAGCATTA Zhang X & Hulett FM (2000): GS FT DP RG
Sun G, et al. (1996): DB
ctaBCDEFG ctaB None Positive 1559161..1559191 None TTGGTAAAATTCATAAAAAGTTCACAAATAA Liu X, et al. (1998): DB
Zhang X & Hulett FM (2000): GS FT
cydABCD cydA SigA Positive 3979448..3979497 -107:-58 GCCGACATAAATAAGCAACAAAATAGACAAAAATCCGTCACATAGTGCGG Puri-Taneja A, et al. (2007): RG FT
narK-fnr fnr SigA Positive 3832301..3832318 -62:-44 CATTCACAAGATTGTTAG Nakano MM, et al. (1996): DB RG
Nakano MM, et al. (2001): RG
qcrABC qcrA SigA Positive ND ND ND Sun G, et al. (1996): DB HB
hemZ hemZ SigA Positive ND ND ND Homuth G, et al. (1999): RG
hmp hmp SigA Positive 1372674..1372713 -79:-39 ATTGATAATTTTGTGACAACTTTATTAAAGATTCATTTTA LaCelle M, et al. (1996): DB
Nakano MM, et al. (2000): DP FT GS
Nakano MM, et al. (2001): RG
ldh-lctP ldh SigA Positive ND ND ND Cruz Ramos H, et al. (2000): RG DB
nasBCDEF nasD None Positive 358251..358294 -83:-39 TAAAATTTTTAGAACTTTTCGTATATTTTGTTACATTTTATAAC Nakano MM, et al. (1998): DB
Nakano MM, et al. (2001): RG
phoPR phoP None Positive ND ND ND Sun G, et al. (1996): DB
resABCDE resA SigA Positive ND ND ND Sun G, et al. (1996): DB
Nakano MM, et al. (2001): RG
sboAX-albABCDEFG sboA SigA Positive ND ND ND Nakano MM, et al. (2000): DB
Nakano MM, et al. (2001): RG
nrdIEF-ymaB ymaA SigA Positive 1868500..1868525 -69:-44 AAAATATGAATTTTTCATAAAAACGA Hartig E, et al. (2006): RG DB SDM




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai