 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | sboAX-albABCDEFG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| sboA | sbo | + | 3836058..3836189 | |||
| sboX | + | 3836146..3836298 | ||||
| albA | ywiA | + | 3836323..3837669 | COG0535R | ||
| albB | ywhR | + | 3837682..3837843 | |||
| albC | ywhQ | + | 3837840..3838559 | COG1131V | ||
| albD | ywhP | + | 3838552..3839862 | |||
| albE | ywhO | + | 3839852..3841012 | COG0612R | ||
| albF | ywhN | + | 3841017..3842297 | COG0612R | ||
| albG | ywhM | + | 3842294..3842995 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Zheng G, et al. (1999), Genbank Z97024 |
| Comments: | The terminator structure proposed in Genbank Z97024 lacks a T-stretch. The secondary structure downstream of sboA may function as a readthrough terminator. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | ND | ND | ND |
Zheng G, et al. (2000): DB |
| ResD | Positive | ND | ND | ND |
Nakano MM, et al. (2000): DB Nakano MM, et al. (2001): RG |
| Rok | Negative | ND | ND | ND |
Albano M, et al. (2005): RG AR DB GS |
| SigA | Promoter | -45:+5 | 3835968..3836017 | AATATATGTATTGAATTAGTAATTTGATAGTTTTAAGATAAAAGTACAAC |
Zheng G, et al. (2000): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CTATGGGGGTAAGGATCTCCCAAAAGGGCATAGTCATTCTACTATGCCCTTTTTAA >>>>>> <<<<<< |
sboX |
|