| Regulated Operon: | csbX-bofC | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups | 
|---|---|---|---|---|---|---|
| csbX | - | 2837469..2838776 | COG2223P | |||
| bofC | - | 2836909..2837421 | 
| Operon evidence: | insertional mutant and examination of bofC expression; plasmids and merodiploid | 
|---|---|
| Reference: | Gomez M & Cutting SM (1997), Gomez M & Cutting SM (1997) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | -50:+10 | 2838793..2838852 | TTTTAATCTAACAGGATTACAATTCAGCAAGCTTGGGTATATACTCCATTGATACTTTAA | Gomez M & Cutting SM (1997): PE | 
| SigF | Promoter | -42:+5 | 2837442..2837488 | ATAAAACGGTTAAGCAGTAGCCTCTTTGGTCAAACTAATCATAAACG | Gomez M & Cutting SM (1997): PE NB | 
| SigG | Promoter | -42:+5 | 2837442..2837488 | ATAAAACGGTTAAGCAGTAGCCTCTTTGGTCAAACTAATCATAAACG | Gomez M & Cutting SM (1997): PE RG | 
| SpoVT | Negative | ND | ND | ND | Bagyan I, et al. (1996): DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TTGAAGACATGTATTCATGTCTTTTTTTTCGTGAAA >>>>>> <<<<<< | bofC | 


| 
 |