| Regulated Operon: | nasA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| nasA | + | 362937..364142 | COG2223P |
| Operon evidence: | Northern blotting (1.3 kb transcript) |
|---|---|
| Reference: | Nakano MM, et al. (1995), Yoshida K, et al. (2003), Ogawa K, et al. (1995) |
| Comments: | Predicted terminator is located inside the nasA coding region. Sequence homology to nearby organisms suggests the presence of a sequence error around 300aa, causing the stop codon to be missed. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GlnR | Negative | -58:-42 | 362838..362856 | GTGTCACAAAAACTTACAC |
Nakano MM, et al. (1995): DP SDM |
| SigA | Promoter | -43:+18 | 362854..362914 | CACATGTCTTTTCCAGAAAATAATGGTCCTATATCCTTGATTCAGAAAATGTAAAATAATG |
Nakano MM, et al. (1995): PE |
| TnrA | Positive | -58:-42 | 362838..362856 | GTGTCACAAAAACTTACAC |
Nakano MM, et al. (1995): DP SDM Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGGATTTTGACGGACACGCGTTTGTGCGTGTCTTTTTTATTTTCTCT >>>>>>> <<<<<<< |
nasA |


|