Regulated Operon: | ptb-bcd-buk-lpdV-bkdAABB |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ptb | bkd | - | 2503765..2504664 | COG0280C | x0587-CLO | |
bcd | yqiT | - | 2502659..2503753 | COG0334E | ||
buk | bkd | - | 2501549..2502640 | COG3426C | x0742-CLO | |
lpdV | bkd | - | 2500104..2501528 | COG1249C | ||
bkdAA | bkd | - | 2499090..2500082 | COG1071C | x0194-BAC | |
bkdAB | bkd | - | 2498093..2499076 | COG0022C | bkdAB-BAC | |
bkdB | bkd | - | 2496796..2498070 | COG0508C | bkdB-BAC |
Operon evidence: | Northern blotting (7.9 kb transcript) |
---|---|
Reference: | Nickel M, et al. (2004), Wang GF, et al. (1993), Yoshida K, et al. (2003) |
Comments: | Northern blotting results in BSORF show various transcripts in this region. Northern blotting experiments by Yoshida et al. show a 8.7 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB transcript. Nickel also found a 10.2 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB transcript due to readthrough at the terminator downstream of bkdR. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
BkdR | Positive | -128:-95 | 2504787..2504820 | AATATGGCCTTGCAAATGAAGGCATGCAATAATT |
Debarbouille M, et al. (1999): DB |
BkdR | Positive | -114:-81 | 2504773..2504806 | AATGAAGGCATGCAATAATTTGCAGAATAAACGC |
Debarbouille M, et al. (1999): DB |
BkdR | Positive | -93:-60 | 2504752..2504785 | GCAGAATAAACGCAAACATCTGCACGAATGTTTC |
Debarbouille M, et al. (1999): DB |
CodY | Negative | ND | ND | ND |
Debarbouille M, et al. (1999): RG |
SigL | Promoter | -34:+8 | 2504685..2504726 | TAAGAGCTGGCATGGAACTTGCATAATAAAAGGCGGAGTCGA |
Debarbouille M, et al. (1999): PE |
TnrA | Negative | ND | ND | ND |
Debarbouille M, et al. (1999): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CAAAAAGAGCATTTTTTGAAGTTTTGTTTCAAAAAATGCTCTTTTTCTATGCTTTATT >>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< |
bkdB |
|