 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yttP |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yttP | - | 3032417..3033040 | COG1309K |
| Operon evidence: | upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PhoP | Positive | ND | ND | ND |
Pragai Z, et al. (2002): DB |
| Spo0A | Positive | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TCAGACCCAAACACAAGCGGGATCTTCTTTTGCTTCGCT >>> <<< |
yttP |
|