 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | BglG/SacY family of transcriptional antiterminators |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | ND |
| Comment | required for substrate-dependent induction and catabolite repression of bglPH |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| bglPH-yxiE | bglP | SigA | Positive | 4035760..4035792 | +25:+57 | GGATTGTTACTGCGAAAGCAGGCAAAACCTAAA |
Kruger S & Hecker M (1995): RG DB Kruger S, et al. (1996): RO DP |
| licT-bglS | bglS | SigA | Positive | 4012766..4012805 | None | TGGTAGGATTGTTACTGATAAAGCAGGCAAAACCTAAATT |
Steinmetz M & Aymerich S (1986): HM Schnetz K, et al. (1996): beta-glucanase activity, RG S1 NB DB OV |
|