Transcription factor: SinR

Factor type	Xre
SWISS-PROT	ND
SubtiList	ND
Consensus seq.	ND
Comment	dual-function regulator which is essential for the late-growth processes of competence and motility and is also a repressor of others, e.g., sporulation and subtilisin synthesis. Might be a leucine zipper protein. In aprE there are two binding sites and SinR binds more strongly to the distal site, which contains two dyad symmetry sites
Link to	Phylogenetic profile, Weight matrix & Motif alignment

Operon	Regulated Gene	Sigma	Regulation	Absolute position	Location	Binding seq.(cis-element)	Experimental evidence
aprE	aprE	SigA	Negative	`1105846..1105891`	`-265:-220`	ATTGTTCTCACGGAAGCACACGCAGGTCATTTGAACGAATTTTTTC	Gaur NK, et al. (1991): DP GS FT Olmos J, et al. (1997): DB RG Ogura M, et al. (2003): DB RG
epr	epr	SigD	Negative	`3939434..3939466`	`-407:-375`	CGGCCCACTCGTTCCCAAACACACTCGCCATGA	Kodgire P, et al. (2006): DP RG GS DB SDM
rok	rok	None	Negative	ND	ND	ND	Hoa TT, et al. (2002): RG DB Hahn J, et al. (1994): DB Van Sinderen D & Venema G (1994): RG DB; Western blot
yqxM-sipW-tasA	yqxM	SigA	Negative	`2555359..2555387`	`-80:-52`	TGAAAACATTCTTTTAAACGAACAAAATG	Chu F, et al. (2006): RG GS FT
yqxM-sipW-tasA	yqxM	SigA	Negative	`2555281..2555311`	`-4:+27`	TTGTGAAGTTCTTTAAAGAGAACGATTGTCA	Chu F, et al. (2006): RG GS FT
eps	yveK	SigA	Negative	`3530036..3530075`	`-163:-124`	TCGTTATTTCGTTCATTATAAGGAATTTTTCGTTCTTTAT	Kearns DB, et al. (2005): GS FT RG
eps	yveK	SigA	Negative	`3529960..3529985`	`-73:-48`	TTTGTTCTCTAAAGAGAACTTATTGG	Kearns DB, et al. (2005): GS FT RG