 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | ND |
|---|---|
| SWISS-PROT | O32197 |
| SubtiList | BG14133 |
| Consensus seq. | ND |
| Comment | Two component system: yvqE/yvqC (LiaS/liaR) responds to perturbations of the cell envelope induced by lipid II interacting antibiotics such as vancomycin, ramoplanin, nisin, and bacitracin. Jordan S, et al. (2006) suggest a model of three component signaling system (LiaFRS) which integrates both positive and negative feed back loops to transduce cell envelop stress signals. (LiaF, putative a membrane protein, is a potent negative regulator of LiaR-dependent gene expression.) |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| yvqIHGFEC | yvqI | SigA | Positive | 3399006..3399035 | -80:-50 | TGCGAGATACGACTCCGGTCTTATATAAAA |
Mascher T, et al. (2003): DB,HB Mascher T, et al. (2004): DP (This result shows candidate region which has two direct repeats, ATGGG{TCCGGT}GCGAGATACGAC{TCCGGT}CTTAT, at -89:-56.) Jordan S, et al. (2007): FT,RG |
| yhcYZ-yhdA | yhcY | None | Positive | 1008562..1008591 | -80:-51 | TTTTTCTCATCCAAAAGTCTGAAAGAAAAT |
Jordan S, et al. (2006): DP, PE, RG, SDM Kobayashi K, et al. (2001): AR |
|