 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | acuABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| acuA | + | 3039134..3039766 | acetoin dehydrogenase | acuA-BAC acuA-STA | ||
| acuB | + | 3039793..3040437 | acetoin dehydrogenase | COG0517 | ||
| acuC | + | 3040434..3041597 | acetoin dehydrogenase | COG0123 |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Grundy FJ, et al. (1993) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | -33:-20 | 3039060..3039073 | TGAAAACGCTTTAT |
Grundy FJ, et al. (1994): DB SDM |
| SigA | Promoter | -49:+18 | 3039044..3039110 | AAAATATAAACCATGTTGAAAACGCTTTATAATTTGGTATTCTTAAAGAAGGCATGTATTTTTGATA |
Grundy FJ, et al. (1994): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACGACCTTTACGAAGAGGTCGTTTTTGATTTTTTAA >>>>>>>> <<<<<<<< |
acuC |
|