 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | bdbDC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| bdbD | yvgV | - | 3437095..3437763 | thiol-disulfide oxidoreductase | COG1651 | bdbD-BAC |
| bdbC | yvgU | - | 3436674..3437090 | thiol-disulfide oxidoreductase | COG1495 |
| Operon evidence: | lacZ gene fusions show that bdbD bdbC have nearly identical expression profiles. |
|---|---|
| Reference: | Meima R, et al. (2002) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | ND | ND |
Meima R, et al. (2002): RG |
| SigE | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGCCCGCGTATGCCGGGCGCTTTTTTAATTTCGCA >>>>>>>> <<<<<<<<< |
bdbC |
|