 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | bofA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| bofA | + | 29770..30033 | bofA-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | |
| Comments: | Northern blotting experiments listed in BSORF show a monocistronic bofA transcript and a longer transcript starting upstream of yaaK, terminating at the same position as the monocistronic transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -39:+2 | 29703..29743 | AGTGGTCTAAACTCCTGGATCTTCTCATAAGCTTGTACTAG |
Ricca E, et al. (1992): DP Ireton K & Grossman AD (1992): PE RG DB OV |
| SpoIIID | Negative | -17:+13 | 29725..29754 | TCTCATAAGCTTGTACTAGAACAAGCGAAG |
Ireton K & Grossman AD (1992): RG DB Halberg R, et al. (1994): FT RO Eichenberger P, et al. (2004): GS AR |
| SpoIIID | Negative | +54:+74 | 29795..29815 | TTATTTTAGGACTGGTTATTC |
Ireton K & Grossman AD (1992): RG DB Halberg R, et al. (1994): FT RO Eichenberger P, et al. (2004): GS AR |
|