 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | comC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| comC | - | 2863652..2864398 | DNA-binding protein | COG1989 | comC-BAC |
| Operon evidence: | S1 nuclease mapping; Northern blotting (0.8 kb transcript) |
|---|---|
| Reference: | Mohan S & Dubnau D (1990), Mohan S, et al. (1989) |
| Comments: | S1 nuclease mapping showed that termination occurs near the center of the TTTTTTT stretch. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | -94:-65 | 2864491..2864520 | AGAATCAAAAAAAGATTCTGCCGTTTTTTT |
Guillen N, et al. (1989): DB RG Van Sinderen D, et al. (1994): DB RG Van Sinderen D, et al. (1995): GS Hamoen LW, et al. (1998): FT |
| ComK | Positive | -65:-36 | 2864462..2864491 | TCATGTGTAAAATTGAATATTCCCAATTGG |
Guillen N, et al. (1989): DB RG Van Sinderen D, et al. (1994): DB RG Van Sinderen D, et al. (1995): GS Hamoen LW, et al. (1998): FT |
| SigA | Promoter | -53:+16 | 2864411..2864479 | TTGAATATTCCCAATTGGAGCTCAGGATGTCCATTTTGCTACAATCCATACCAGAACTCAATGAGTAAA |
Mohan S, et al. (1990): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTTTTGGACAAGGCGACAAAAGTCTTGTTCTTTTTTTCTTTGCCT >>>>>>>>> <<<<<<<<< |
comC |
|