 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | comFABC-yvyF-flgM-yvyG-flgKL |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| comFA | - | 3641197..3642588 | late competence protein | COG4098 | ||
| comFB | - | 3640841..3641137 | ||||
| comFC | - | 3640155..3640844 | COG1040 | |||
| yvyF | yviB | - | 3639662..3640081 | |||
| flgM | - | 3639315..3639581 | anti-sigma factor repressor of sigma-D-dependent transcription | COG2747 | ||
| yvyG | yviC | - | 3638817..3639299 | |||
| flgK | - | 3637275..3638798 | flagellar hook-associated protein 1 (HAP1) | COG1256 | x1601-BAC | |
| flgL | yviD | - | 3636368..3637264 | flagellar hook-associated protein 3 (HAP3) | COG1344 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Londono-Vallejo JA & Dubnau D (1993), Soldo B, et al. (1996), Mirel DB, et al. (1994), Liu J & Zuber P (1998), Serizawa M, et al. (2004) |
| Comments: | Insertion mutations and RT-PCR by Liu & Zuber showed the presence of a comF-flgM transcript, suggesting that the stem-loop downstream of comFC functions as a readthrough terminator. Soldo et al. suggest that the stem-loop structure downstream of flgL may be an mRNA stabilizer rather than a terminator. In that case, the operon would also contain the genes yviE, yviF, and csrA. Serizawa et al. show that yviE-yviF, like the operon containing yvyF, are SigD-dependent. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | -92:-63 | 3642668..3642697 | ATAAGGCCAAATCTCCGTTTTTAGAGCGGA |
Londono-Vallejo JA, et al. (1993): DB RG Van Sinderen D, et al. (1995): GS RG OV Hamoen LW, et al. (1998): FT Liu J & Zuber P (1998): DB Ogura M, et al. (2002): AR RG DB |
| ComK | Positive | -63:-33 | 3642638..3642668 | AGATTTTTTTATATTCTTATTTTAATAGTTG |
Londono-Vallejo JA, et al. (1993): DB RG Van Sinderen D, et al. (1995): GS RG OV Hamoen LW, et al. (1998): FT Liu J & Zuber P (1998): DB Ogura M, et al. (2002): AR RG DB |
| SigA | Promoter | -46:+19 | 3642587..3642651 | TATTTTAATAGTTGGACAGAAAATATTCATTCAGGCATACTGTTTCGAAAGGAGGCGTGCTATGT |
Londono-Vallejo JA, et al. (1993): PE S1 |
| SigD | Promoter | -40:+5 | 3640119..3640163 | AGAAGCTAAATGATTCTGTTTTTATGCCGATATAATCACTAGAAA |
Gilman MZ, et al. (1981): S1 RO, in-vitro transcription Gilman MZ & Chamberlin ML (1982): S1 Mirel DB, et al. (1994): RO |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTGATCAGAAGCTAAATGATTCTGTTTTTATGCCGATAT >>>>> <<<<< |
comFC | |||
| AGTAAGCGGCTCTTAGGAGTTCGCTTTTTTTATAGTTCA >>>>>>> <<<<<<<< |
flgL |
|