| Regulated Operon: | cotF | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| cotF | + | 4166134..4166616 | spore coat protein | 
| Operon evidence: | Northern blotting; upstream and downstream genes are transcribed in the opposite direction | 
|---|---|
| Reference: | BSORF | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigK | Promoter | -43:+2 | 4166063..4166107 | AACATCATGAACAACATTGAGCGTTGGGCATATGCTGATATGGAA | Cutting S, et al. (1991): PE | 
| SpoIIID | Positive | ND | ND | ND | Eichenberger P, et al. (2004): GS AR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAACAAGCAGCAAAGGAGTTCCCTTTGCTGCTATTTCTGCTGATCCTT >>>>>>>>>>> <<<<<<<<<<< | cotF | 


| 
 |