| Regulated Operon: | cotVWX | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| cotV | - | 1250943..1251329 | spore coat protein (insoluble fraction) | |||
| cotW | - | 1250585..1250902 | spore coat protein (insoluble fraction) | |||
| cotX | - | 1249968..1250486 | spore coat protein (insoluble fraction) | 
| Operon evidence: | Northern blotting (1.6 kb transcript) | 
|---|---|
| Reference: | Zhang J, et al. (1994), Zhang J, et al. (1993) | 
| Comments: | The internal promoter in front of cotX leads to a 0.6 kb transcript. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| GerE | Positive | -53:-32 | 1251385..1251406 | AAATTGGTTATTTTTATTATTC | Zhang J, et al. (1994): FT RO | 
| SigK | Promoter | -42:+6 | 1251348..1251395 | TTTTATTATTCCGCTCTGCACCCCATTTGCATTATATAGAGTATGGAT | Zhang J, et al. (1994): NB PE DB RO | 
| GerE | Positive | -70:-50 | 1250557..1250577 | TAAAAAATAGGGTTCTTCATC | Zhang J, et al. (1994): FT RO | 
| GerE | Positive | -50:-32 | 1250539..1250557 | CAGGATATATGACTCAGTC | Zhang J, et al. (1994): FT RO | 
| SigK | Promoter | -43:+5 | 1250503..1250550 | TATGACTCAGTCAAAATAAGAGGCTCGCTCATTTAATAACAGTAAAAG | Zhang J, et al. (1994): NB PE DB RO | 
| SpoIIID | Negative | -35:-7 | 1250513..1250542 | AGTCAAAATAAGAGGCTCGCTCATTTAATA | Ichikawa H, et al. (2000): GS FT | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TAAAAGCAGAGCTAAAAACGCTCTGCTTTTTCTTATTTTCC >>>>>>> <<<<<<< | cotX | 


| 
 |