 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | csbB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| csbB | yfhN | + | 930154..931143 | stress response protein | COG0463 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Akbar S & Price CW (1996) |
| Comments: | Northern blotting results in BSORF show a csbB, a csbB-yfhO, and a yfhO transcript. Perhaps due to a sequencing error, Akbar & Price suggest a slightly different terminator. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -43:+3 | 930046..930091 | AAAAAACAGGTTTAAACGACTTTAAAAAAAGGAATAGCCTTACTGA |
Akbar S & Price CW (1996): RG Huang X & Helmann JD (1998): PE RG |
| SigX | Promoter | -36:+6 | 930038..930079 | ATTGTAACAAAAAACAGGTTTAAACGACTTTAAAAAAAGGAA |
Huang X & Helmann JD (1998): PE RG DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ACCAAGCGCCATTGGCAGTGCTTTTTTTGCGTGTCT >>>>> <<<<<< |
csbB |
|