| Regulated Operon: | ctpB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yvjB | ctpB | - | 3621386..3622828 | COG0793 | 
| Operon evidence: | downstream gene is on the opposite strand | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | ND | ND | ND | Pan Q, et al. (2003): RG DB, gfp assay | 
| SigG | Promoter | -39:+14 | 3622857..3622909 | GATTACATGAAATCTCCATCCTTTACATATACTATCTCTAGGTTTTGGTAAAG | Wang S, et al. (2006): AR, Race-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TGTCAATTAAAGGAGATGGTATTTCATCTCCTGTTTCTTTGTGCTTAA >>>>>>>>> <<<<<<<<< | yvjB | 


| 
 |