 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | deoR-dra-nupC-pdp |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| deoR | yxxC | - | 4051396..4052337 | transcriptional regulator | COG2390 | x0511-BAC |
| dra | - | 4050655..4051290 | deoxyribose-phosphate aldolase | COG0274 | dra-BAC-1 dra-BAC-2 | |
| nupC | - | 4049358..4050539 | pyrimidine-nucleoside transport protein | COG1972 | nupC-BAC-1 nupC-STA x1697-BAC | |
| pdp | - | 4048027..4049328 | pyrimidine-nucleoside phosphorylase | pdp-BAC |
| Operon evidence: | Northern blotting (4.5 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000), Yoshida K, et al. (1995), Saxild HH, et al. (1996) |
| Comments: | A 3.4 kb dra-nupC-pdp transcript was also detected, as well as a monocistronic (1.0 kb) dra transcript terminating at the putative readthrough terminator downstream of dra. Northern blotting results by Yoshida also showed a monocistronic (0.8 kb) deoR transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | +62:+84 | 4051238..4051260 | GCTTTGAAACCGCATACACAAAA |
Miwa Y, et al. (2000): RG |
| DeoR | Negative | -60:-22 | 4051341..4051379 | ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAA |
Zeng X, et al. (2000): GS FT Zeng X & Saxild HH (1999): DP RG DB SDM GS Saxild HH, et al. (1996): DB HM |
| SigA | Promoter | -60:+12 | 4051310..4051379 | ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAAAAGTCGGTTATGCTAAAAAATATCTTAACAA |
Saxild HH, et al. (1996): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATAAAGCACATCCCATGCTGAGCGGGGTGTGCTTTTTTAATTATAGG >>>>>>>>> <<<<<<<<< |
pdp | |||
| GCTGACGGAAGGCAGACTGCTTTCCGTTTTCTGAGGAAACA >>>>>>>>> <<<<<<<<< |
dra |
|