 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | fur |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| fur | yqkL | - | 2449029..2449478 | transcriptional regulator (Fur family) | COG0735 | fur-BAC |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Fuangthong M, et al. (2002) |
| Comments: | Northern blotting results in BSORF show a fur-ripX-drm-punA transcript and a monocistronic fur transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PerR | Negative | -61:-29 | 2449534..2449566 | TTATTTATCAGTTTATAATAATTATAGTTGGAA |
Fuangthong M, et al. (2002): FT |
| SigA | Promoter | -39:+9 | 2449497..2449544 | TATAGTTGGAACTCTGCGCGTATTTTGTTATAATGAGTCATGGAATGC |
Fuangthong M, et al. (2002): PE HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCGAACCTTTTCTCATGGGGAAAGGGTTTTTTGCTGTTTCT >>>>>>>>> <<<<<<<<< |
fur |
|