| Regulated Operon: | gltC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gltC | + | 2013989..2014891 | transcriptional regulator (LysR family) | COG0583 |
| Operon evidence: | upstream and downstream genes transcribed in the opposite direction |
|---|---|
| Reference: | Genbank AF006720 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GltC | Negative | +5:+19 | 2013955..2013969 | ATCTCAAAATGAGAT |
Belitsky BR, et al. (1995): SDM DP Bohannon DE, et al. (1989): S1 |
| SigA | Promoter | -46:+17 | 2013903..2013965 | TCATTGTAGGTTTTCAAAACGATATAAACAATATATAATTTAGATCAAAAGAATCTCAAAATG |
Bohannon DE, et al. (1989): S1 |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATGAACCCGAGCTTCTATATAGAAGCTTCGGGTTTTTTTCTGCAAAT >>>>>>>>>>> <<<<<<<<<<<< |
gltC |


|