 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gltR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gltR | yrdL | + | 2725063..2725953 | transcriptional regulator (LysR family) | COG0583 | x1300-BAC |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GltR | Negative | -10:+5 | 2725007..2725021 | ATTCAAAATTAAGAT |
Belitsky BR, et al. (1997): DB DP SDM |
| GltR | Negative | +3:+37 | 2725019..2725053 | GATGGAAGACATCTCAAAATCAGATATCAACTATG |
Belitsky BR, et al. (1997): DB DP SDM |
| SigA | Promoter | -50:+9 | 2724967..2725025 | TCTAAGCTTTAGTTTACATGAAGCTCTGCTATCATATATAATTCAAAATTAAGATGGAA |
Belitsky BR & Sonenshein AL (1997): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TATAGAGCAAAAAAGCAAACTTCGGTATGTAGTTTGCTTTTTCTTCG >>>>>> <<<<<< |
gltR |
|