 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | LysR |
|---|---|
| SWISS-PROT | P94501 |
| SubtiList | BG11942 |
| Consensus seq. | T-----------A |
| Comment | it activates the transcription of gltAB in the absense of the normal regulator, GltC. It also negatively regulates its own expression. cf. GltC |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| gltAB | gltA | SigA | Positive | 2013955..2013969 | -71:-57 | ATCTCATTTTGAGAT |
Belitsky BR, et al. (1997): DB DP SDM |
| gltAB | gltA | SigA | Positive | 2013933..2013947 | -49:-35 | ATCTAAATTATATAT |
Belitsky BR, et al. (1997): DB DP SDM |
| gltR | gltR | SigA | Negative | 2725007..2725021 | -10:+5 | ATTCAAAATTAAGAT |
Belitsky BR, et al. (1997): DB DP SDM |
| gltR | gltR | SigA | Negative | 2725019..2725053 | +3:+37 | GATGGAAGACATCTCAAAATCAGATATCAACTATG |
Belitsky BR, et al. (1997): DB DP SDM |
|