Regulated Operon: | malA-yfiA-malP |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
malA | glvG, glvA | + | 889357..890706 | 6-phospho-alpha-glucosidase | COG1486 | x0958-STA |
yfiA | glvR | + | 890771..891535 | COG1737 | yfiA-STR | |
malP | glvC, yfiB | + | 891550..893133 | phosphotransferase system (PTS) maltose-specific enzyme IICB component | COG1263 | x1644-STA |
Operon evidence: | Northern blotting (3.8 kb transcript) |
---|---|
Reference: | Yamamoto H, et al. (2001), Genbank D50543 |
Comments: | Readthrough terminator exists downstream of malA, leading to a 1.4 kb transcript. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CcpA | Negative | -7:+10 | 889324..889350 | TGGAATTGTAAACGTTATCAAGGAGGT |
Yamamoto H, et al. (2001): RG PE SDM |
YfiA | Positive | ND | ND | ND |
Yamamoto H, et al. (2001): RG PE |
SigA | Promoter | -42:+5 | 889289..889335 | AACGTGTTACGGGACGAGCTATCTCATGGTATAAATGGAATTGTAAA |
Yamamoto H, et al. (2001): PE NB RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GACTGCCCTCCTTTTCGGGAGGGTTTTCGTTTGCCGTC >>>>>>> <<<<<<< |
malP |
|