| Regulated Operon: | nadE | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| nadE | outB, tscBGH, gsp-81 | + | 337848..338666 | NH3-dependent NAD+ synthetase | COG0171 | nadE-BAC | 
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand | 
|---|---|
| Reference: | Albertini AM, et al. (1987) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigA | Promoter | -43:+3 | 337721..337766 | TCTCTTGTTCACAGTGAATGAAGACCTGTGCTATATTTAATAGGGA | Antelmann H, et al. (1997): PE | 
| SigB | Promoter | -42:+9 | 337773..337823 | ACAGTCATGATTCATTTTCATTGATTTAGGGAAATGATCAGTAATAAGGGA | Antelmann H, et al. (1997): NB PE | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AGAAAGCCCGCTCTCGGAGCGGGCTTTTGTCGTGTACAG >>>>>>>> <<<<<<<< | nadE | 


| 
 |