 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | nrgAB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| nrgA | + | 3755812..3757026 | ammonium transporter | COG0004 | ||
| nrgB | + | 3757038..3757388 | nitrogen-regulated PII-like protein | COG0347 |
| Operon evidence: | primer extension analysis of nrgA and nrgB transcripts; Northern blotting (1.6 kb transcript) |
|---|---|
| Reference: | Wray LV Jr, et al. (1994), Yoshida K, et al. (2003) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -47:+18 | 3755720..3755784 | TCTTACATGAAAATGTTTTATCATTCTTTTTTCTCTATAATGAAGAAATATAATAATTGCTTTTT |
Wray LV Jr, et al. (1994): PE |
| TnrA | Positive | -57:-41 | 3755710..3755726 | TGTCAGGAAATCTTACA |
Wray LV Jr, et al. (1996): RG DB Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGTACGAGATTCGGACACTCCGGATCTCTTTTTTTGTGCACAG >>>>>>>>>> <<<<<<<<<< |
nrgB |
|