 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | oppABCDF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| oppA | spo0KA | + | 1219162..1220799 | oligopeptide ABC transporter (binding protein) | COG4166 | oppA-BAC-1 oppA-BAC-2 oppA-LAB x0571-BAC x0772-BAC x0799-BAC x1530-STA |
| oppB | spo0KB | + | 1220907..1221842 | oligopeptide ABC transporter (permease) | COG0601 | oppB-BAC oppB-STA stu1441-STR x0140-BAC x0484-BAC x1218-BAC x1303-BAC |
| oppC | spo0KC | + | 1221846..1222763 | oligopeptide ABC transporter (permease) | COG1173 | x0178-BAC x0494-BAC x1458-BAC |
| oppD | spo0KD | + | 1222768..1223844 | oligopeptide ABC transporter (ATP-binding protein) | COG0444 | appD-BAC-1 appD-STA |
| oppF | spo0KE | + | 1223846..1224763 | oligopeptide ABC transporter (ATP-binding protein) | COG4608 |
| Operon evidence: | Northern blotting (6.0 kb transcript) |
|---|---|
| Reference: | Perego M, et al. (1991), Yoshida K, et al. (2003) |
| Comments: | The secondary structure of the RNA corresponding to the oppA-oppB intergenic region may enhance the stability of the mRNA molecule (Perego), or function as a readthrough terminator (1.8 kb oppA transcript found by Yoshida). |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Hpr | Negative | ND | ND | ND |
Koide A, et al. (1999): DB OV |
| TnrA | Positive | ND | 1218931..1218947 | TGGAAGAAAAACTAACG |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATCAATCCTTCAAGAGATTTCTCTTGAAGGATTTTTTTGCGTCTTC >>>>>>>>>>> <<<<<<<<<<< |
oppF |
|