 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | pabBAC-sul-folBK-yazB-yacF-lysS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| pabB | pab | + | 82861..84273 | para-aminobenzoate synthase (subunit A) | COG0147 | pabB-BAC |
| pabA | trpG, trpX | + | 84287..84871 | anthranilate synthase (subunit II) | COG0512 | pabA-BAC x0931-STA |
| pabC | + | 84871..85752 | aminodeoxychorismate lyase | COG0115 | ||
| sul | + | 85734..86591 | dihydropteroate synthase | COG0294 | ||
| folB | folA, yacE | + | 86584..86946 | dihydroneopterin aldolase | COG1539 | |
| folK | + | 86943..87446 | 7,8-dihydro-6-hydroxymethylpterin pyrophosphokinase | COG0801 | ||
| yazB | + | 87398..87607 | COG1396 | |||
| yacF | + | 87631..88632 | COG0042 | x1602-BAC | ||
| lysS | + | 88724..90223 | lysyl-tRNA synthetase | COG1190 | lysS-BAC-1 lysS-BAC-2 |
| Operon evidence: | Northern blotting (7.5 kb transcript) |
|---|---|
| Reference: | De Sazieu A, et al. (1997), BSORF |
| Comments: | Readthrough terminators after pabA (undefined) and yacF result in a 2.1 kb transcript and a 5.9 kb transcript, respectively. Promoter deletions, reporter gene fusions, and Northern blotting (1.5 kb transcript) suggested the existence of an internal promoter in front of lysS. The MtrB product (TRAP) causes translational attenuation at the pabA ribosomal binding site under conditions of excess tryptophan. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -43:+7 | 82785..82834 | GAAATTCACTTTTTTCACTAACAACATTGCTTTACAATTAAAAACAAGTA |
De Saizieu A, et al. (1997): PE RG NB |
| MtrB | Negative | ND | 84233..84284 | GAGCATTAGAGCTGAGCGAAGAAGAGACAAAAATTAGATGAGGTGAGCGGAG |
Kane JF (1977): DB, anthranilate synthase activity, tryptophan excretion measurement Babitzke P, et al. (1994): filter binding assay Yang M, et al. (1995): RG DP SDM Lee AI, et al. (1996): DB RG Du H, et al. (1997): FT, in-vitro translation Valbuzzi A & Yanofsky C (2001): DB RG Yakhnin H, et al. (2004): RG DB GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGAGCGGTATCCTCCATAGGGAAAGGATGCCGCTCTTTTTAAATCCCTTA >>>>>>>>>>>>>> <<<<<<<<<<<<<<<< |
lysS | |||
| GCTCACTGCTAGTTTTACGCTGGCAGTTTTTCTGCTTTTTT >>>>>>>> <<<<<<<< |
yacF |
|