 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | rapA-phrA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| rapA | gsiAA, spo0L | + | 1315179..1316315 | response regulator aspartate phosphatase | COG0457 | |
| phrA | gsiAB | + | 1316305..1316439 | inhibitor of the activity of phosphatase RapA |
| Operon evidence: | hybrid formation with RNA probes; nuclease protection experiments |
|---|---|
| Reference: | Mueller JP, et al. (1992), Genbank AF034138 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComA | Positive | -75:-36 | 1315073..1315112 | TTGCGGTTAGCCGAAATTCGACAATTGCGGTTATTTTGCG |
Mueller JP, et al. (1992): DP RO DB |
| SigA | Promoter | -50:+19 | 1315098..1315166 | TGCGGTTATTTTGCGTTCTTCTTTTTCTTGTAAATATGATAAAATATGACATATCTCGGGTAATTCAAA |
Mueller JP, et al. (1992): PE Jarmer H, et al. (2001): PE SDM HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGACCCTTAGGGGTCTTTTTTATTTCTTCA >>>>> <<<<< |
phrA |
|