Regulated Operon: | rsbRSTUVW-sigB-rsbX |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
rsbR | ycxR | + | 518969..519793 | COG1366 | ||
rsbS | ycxS | + | 519798..520163 | antagonist of RsbT | COG1366 | |
rsbT | ycxT | + | 520167..520568 | switch protein/serine-threonine kinase | COG2172 | |
rsbU | + | 520580..521587 | serine phosphatase | COG2208 | rsbU-STA x0328-BAC | |
rsbV | + | 521649..521978 | anti-anti-sigma factor (antagonist of RsbW) | COG1366 | rsbV-BAC rsbV-STA | |
rsbW | + | 521975..522457 | switch protein/serine kinase and anti-sigma factor (inhibitory sigma-B binding protein) | COG2172 | ||
sigB | rpoF | + | 522417..523211 | RNA polymerase sigma-37 factor (sigma-B) | COG1191 | |
rsbX | + | 523211..523810 | serine phosphatase |
Operon evidence: | S1 nuclease mapping of 3' end; lacZ fusion to rsbV; the promoter in front of rsbR was the only promoter detected in the rsbRSTU region |
---|---|
Reference: | Kalman S, et al. (1990), Wise AA & Price CW (1995) |
Comments: | The S1 nuclease mapping showed that transcription ends in the T-stretch of the indicated terminator (positions 523844..523849). Internal promoter in front of rsbV. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigA | Promoter | -45:+21 | 518878..518943 | AGAGCAACTTTTTTTGTTTTCAAAAAACATAAACGATATAATAGTGAAATAACGAAAAAATATGTT |
Wise AA, et al. (1995): PE |
SigB | Promoter | -40:+3 | 521577..521619 | GAAAGGTTTAACGTCTGTCAGACGAGGGTATAAAGCAACTAGT |
Kalman S, et al. (1990): PE S1 DB RG Boylan SA, et al. (1993): PE; Western blot; RG Voelker U, et al. (1994): 2D PAGE, HB |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGAAGCTGGACATCCGGCTTCTTTTTTTTGCGGTTG >>>>>>>> <<<<<<<< |
rsbX |
|