| Regulated Operon: | sacXY | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| sacX | ipa-14r, sacS | + | 3941255..3942634 | negative regulatory protein of SacY | COG1263 | |
| sacY | ipa-13r, sacS | + | 3942688..3943530 | transcriptional antiterminator | COG3711 | 
| Operon evidence: | lacZ gene fusion | 
|---|---|
| Reference: | Zukowski MM, et al. (1990), Glaser P, et al. (1990), Crutz AM & Steinmetz M (1992) | 
| Comments: | Binding of SacT (at low sucrose concentration) and by both SacT and SacY (at higher concentrations) to the ribonucleic antiterminator (RAT) sequence prevents formation of the terminator in the sacXY promoter, allowing transcription of the downstream sequence. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| DegU | Positive | -112:-56 | 3940856..3940912 | GTCTTAAAGGTTTTTTTCATTCTAAGAACACCACACACAACCTTTTTCCCATCCATT | Crutz AM & Steinmetz M (1992): DB RG DP | 
| SacT | Positive | +19:+61 | 3940986..3941028 | TATGGCGGGATTGTGACTGGGCAGGCAGGCAAGACCCAATGAT | Tortosa P, et al. (1995): RG SDM DP | 
| SacY | Positive | +19:+61 | 3940986..3941028 | TATGGCGGGATTGTGACTGGGCAGGCAGGCAAGACCCAATGAT | Tortosa P, et al. (1995): RG SDM DP | 
| SigA | Promoter | -48:+20 | 3940920..3940987 | CTTTTCATACTATTGCTATACAGCCATGAACAGCATAAAATGAACGTTATTACAGTTATCACCACATA | Crutz AM & Steinmetz M (1992): PE | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAACGCTTTTGATCATCTCAAAAGCGTTTTTTTATCTGATT >>>>>>>>> <<<<<<<<< | sacY | |||
| ATTCTCATGCTCCGTCGTCGACGCGGGCATTTTTGTCATTTTCA >>>>>>>>> <<<<<<<<<< | sacX | 


| 
 |