 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | sigH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sigH | spo0H | + | 116597..117253 | RNA polymerase sigma-30 factor (sigma-H) | COG1595 | sigH-BAC sigH-BAC |
| Operon evidence: | ND |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | -35:+5 | 116537..116576 | TGACGCTTTTTTGCCCAATACTGTATAATATTTCTATCTA |
Zuber P, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.123-127: DB RG Strauch MA, et al. (1995): FT |
| SigA | Promoter | -45:+18 | 116527..116589 | TAGATTAAGTTGACGCTTTTTTGCCCAATACTGTATAATATTTCTATCTACGTGCGCCGGGGG |
Weir J, et al. (1991): PE |
|