 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | spoIVFAB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| spoIVFA | bofB, spoVL | - | 2856058..2856852 | COG0739 | ||
| spoIVFB | - | 2855199..2856065 | membrane metalloprotease | COG1994 |
| Operon evidence: | transcriptional fusions |
|---|---|
| Reference: | Cutting S, et al. (1991) |
| Comments: | The transcriptional fusions show that the transcript does not extend more than 74 base pairs from the spoIVFB stop codon. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -46:+6 | 2856877..2856928 | TTCTTGACTAAACCGAATATTTGCCATGGACAAGACATATGATGTACAAACC |
Cutting S, et al. (1991): PE RG |
| SpoIIID | Negative | ND | ND | ND |
Eichenberger P, et al. (2004): GS AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CTAAAACTGATTGACAAACGCCTTGTATTTTGGTATATTTTTTAATGTTATG >>>>>>>>>>>> <<<<<<<<<<<< |
spoIVFB |
|