| Regulated Operon: | spoVB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| spoVB | spoIIIF | + | 2828790..2830346 | COG2244 | 
| Operon evidence: | upstream and downstream genes are in opposite directions | 
|---|---|
| Reference: | Popham DL & Stragier P (1991) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | ND | 2828712..2828754 | CTTGTCATGCTTGGACGACATATACGCATATCTTTATTGTATA | Popham DL & Stragier P (1991): RG | 
| SpoIIID | Negative | ND | ND | ND | Eichenberger P, et al. (2004): GS AR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CGATAATGGTCACGTGCGGTGCCCATCTTTTTCATCAATATA >>>>>>>> <<<<<<<< | spoVB | 


| 
 |