Regulated operon: trpEDCFBA-hisC-tyrA-aroE

Regulated Operon:

trpEDCFBA-hisC-tyrA-aroE

Genes

Genes	Synonyms	Direction	Genome position	Function	COG ID	Genus clusters
trpE		-	2375068..2376615	anthranilate synthase	COG0147	x1522-STA
trpD		-	2374080..2375096	anthranilate phosphoribosyltransferase
trpC		-	2373335..2374087	indol-3-glycerol phosphate synthase
trpF		-	2372683..2373330	phosphoribosyl anthranilate isomerase
trpB		-	2371500..2372702	tryptophan synthase (beta subunit)
trpA		-	2370704..2371507	tryptophan synthase (alpha subunit)	COG0159
hisC	aroJ	-	2369611..2370693	tyrosine/phenylalanine aminotransferase	COG0079	x1197-BAC x1361-STA x1594-BAC
tyrA		-	2368447..2369562	prephenate dehydrogenase	COG0287	tyrA-STA
aroE		-	2367150..2368436	5-enolpyruvoylshikimate-3-phosphate synthase	COG0128	aroE-BAC aroE-STA

Operon evidence:	integrative plasmids to interrupt transcription
Reference:	Shimotsu H & Henner DJ (1984), Henner DJ, et al. (1985), Henner DJ, et al. (1986), Shimotsu H, et al. (1986), Babitzke P & Gollnick P (2001)
Comments:	Transcription starting from the promoter in front of aroF leads to an aroFBH-trpEDCFVA-hisC-tyrA-aroE transcript and an aroFBH transcript, terminating at the terminator/antiterminator structure in front of trpE, as shown by Northern blotting, 3' S1 nuclease mapping, promoter deletions, site-directed mutagenesis, and reporter gene fusions. Readthrough transcription takes place under tryptophan limitation. The MtrB product (TRAP) causes both transcriptional and translational attenuation. In case of transcriptional attenuation, termination occurs at the GT in the T-stretch TTTATTTGT. NusA stimulates transcriptional pausing and termination. Translational attenuation may be followed by transcriptional attenuation further downstream: The absence of the ribosome allows access of the Rho protein to the nascent mRNA transcript, resulting in Rho-dependent transcriptional termination. An internal promoter may exist upstream of hisC.

Promoters

Binding factor	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Rho	Negative	ND	ND	ND	Yakhnin H, et al. (2001): DB RG HB
SigA	Promoter	`-47:+8`	2376811..2376865	`CCGATTTATCATTGACAAAAAATACTGAATTGTAATACGATAAGAACAGCTTAGA`	Shimotsu H & Henner DJ (1984): S1 DP RG Shimotsu H, et al. (1986): S1
MtrB	Negative	ND	2376728..2376783	`TAGAATGAGTTGAGTTAGAGAATAGGGTAGCAGAGAATGAGTTTAGTTGAGCTGAG`	Steinberg W (1974): anthranilate and tryptophan synthase measurement Kane JF (1977): DB, tryptophan excretion measurement Shimotsu H & Henner DJ (1984): DP Shimotsu H, et al. (1986): NB DP SDM RG Kuroda MI, et al. (1988): DP RG Gollnick P, et al. (1990): DB RG OV Babitzke P, et al. (1992): RG OV Otridge J & Gollnick P (1993): RO NB GS Babitzke P & Yanofsky C (1993): RO NB OV GS DP Babitzke P, et al. (1994): filter binding assay, FT Antson AA, et al. (1995): DP RG SDM Merino E, et al. (1995): RG SDM DP Lee AI, et al. (1996): DB RG DP Yang M, et al. (1997): RG GS DB Du H & Babitzke P (1998): RG DB, in-vitro translation, ribosome toeprint, RNA structure mapping Sudershana S, et al. (1999): DP RG SDM DB GS OV NB, in-vitro transcription Du H, et al. (2000): GS FT RG DP Valbuzzi A & Yanofsky C (2001): DB RG Yakhnin AV & Babitzke P (2002): RO

Terminator

Terminator sequence	Absolute position	Position from stop codon	Free energy [kcal/mol]	Downstream of
`CATTATGTTTATTCTACCCAAAAGAAGTCTTTCTTTTGGGTTTATTTGTTATATA >>>>>>>>>> <<<<<<<<<<`	2376687..2376710	-1642..-1619	-14.9	trpE
`AAAAATCCTGAAGTTTTACTTCAGGATTTTTTATGCAGATC >>>>>>>>> <<<<<<<<<`	2367135..2367155	-5..15	-14.6	aroE

Overview

Upper Region

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai