| Regulated Operon: | ybaN | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ybaN | ybxG | - | 159778..160542 | COG0726 | 
| Operon evidence: | transcription upstream and downstream of ybaN proceeds in the opposite direction | 
|---|---|
| Reference: | Eichenberger P, et al. (2003) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -35:+9 | 160572..160615 | TCGGTTATATTCAATTGTCCATGCTCATAAGATGTAAAACAAGA | Eichenberger P, et al. (2003): AR, 5'-RACE-PCR | 
| SpoIIID | Negative | ND | ND | ND | Eichenberger P, et al. (2004): GS AR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CAAATGTTTTCTTAGAGGACTGCTTTTGCTTTATATAA >>>>>> <<<<<< | ybaN | 


| 
 |