| Regulated Operon: | ycgFG | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ycgF | + | 334192..334821 | COG1280 | |||
| ycgG | + | 334891..335652 | COG3403 | 
| Operon evidence: | downstream gene ycgH is in the opposite direction; no experimental evidence that ycgF and ycgG are in the same operon | 
|---|---|
| Reference: | Eichenberger P, et al. (2003) | 
| Comments: | Northern blotting results in BSORF show a ycgEFG and a ycgG transcript. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -37:+9 | 334125..334170 | TTGTGCATAGCTTGGCCCGTTCCCGAATAAATTGTACAAGTTACAT | Eichenberger P, et al. (2003): AR, 5'-RACE-PCR | 
| SpoIIID | Negative | ND | ND | ND | Eichenberger P, et al. (2004): GS AR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CTGGCAGGGCGATCTTTGTGACCCTACTTTTTTTGATAGATC >>>>>> <<<<<<< | ycgG | 


| 
 |